Last week, I received an interesting email from Unspeakable Axe telling me he had a post idea for me. “I only have the title”, he said: ”How the hell my submissive lucked out and became owned by me and how you can find someone like me?”

Good question, Axe, good question. I was at Boy Toy’s when I read this email and of course, I immediately asked him how he thought he got to be owned by me. He gave me this very inspiring and eloquent answer: “I don’t know. I just got lucky.”

So much for that.

Still, over the last few days, I’ve given the matter some thought. The truth is, I believe Boy Toy and I are where we are today because we started pretty much like any other, normal relationship, and we fell in love. The elements of kink, or D/s, that we do have in our relationship now were introduced gradually, and our communication about such things was always open. I mentioned this in my very first post:

But Boy Toy told me from the start what he was into. He wanted to be straight with me, and avoid my learning this about him from other people, too. He was also very respectful. He was so scared of pushing me into something I didn’t want that I almost had to trick him into sleeping with me, in the beginning. Ok, ok, I didn’t “trick” him, but I kind of had to push him into it a little. And we started with good old regular sex, of course.

But the fact of the matter was, I knew what he was into, and, as they say, curiosity killed the cat. We talked a lot about kink. And it was fun, it was playful and naughty. And it felt like we had this dirty little secret, it created this complicity between us.

But let’s back track a little, I want to tell you how things first started. I met Boy Toy sometime in the summer of 2006, a year or so before we actually hooked up. We met in a bar, or rather, outside the bar, at the end of the night. Everyone was leaving and me and my friends and he and his friends just started talking and joking around. We were drunk. Boy Toy and I decided we should exchange contact information and so I gave him my email address.

The next day, or a few days later, I don’t remember, I received an email from Boy Toy. In fact, I still have those very first emails, and I thought they were too cute not to share:

Boy Toy: OK, checking to see if this is the right address to Elle, are you there?

His email included one of those signatures you can set up to appear in all your emails, and his contact information ended with this:

Sex:                Yes.
DNA:               ACAAGATGCCTGCTGCTGCTCTCCGGGGCC…

So, my answer to his email was: Yes, I’m here. And thanks for the DNA sequence, I was really looking forward to getting it

Boy Toy’s answer: Just don’t cross that DNA with a chicken, it’s going to get very ugly.

Mine: Ok, I’ll try not to. Thanks for the advise. How about with a moose?

And his: Moose is OK, I’d like to have antlers to push cars out of my way. OK, going cycling. Hard workout time.  Back in a few hours. Not coming up in the neighborhood tonight? If so let me know, we can go for coffee.

I didn’t go for coffee, but we started chatting pretty regularly. We didn’t hit it off, either. Our age difference freaked me out a little… He’s in his 40s, I’m 30. I know, I know, big deal. But back then, it bothered me.

It’s around that time, too, that Boy Toy told me of his kinky side. He told me if I started hanging around him, people would start talking, they’d start saying I was getting into fetish stuff. Hah. Well I didn’t care about that. People can think whatever they want.

So we continued chatting online a little, and we’d occasionnally run into each other at the club. Everytime we did, we’d talk. He’d pinch my waist and tell me I was pretty. I remember one time in particular, we were dancing and I was in jeans and a tshirt, really casual-looking, and he told me “You’re too hot for this place!”

As for me, I’d notice as soon as he’d walk into the place. I’d mention to my friends he had arrived. If he walked past me without seeing me, I usually poked him or punched him on the shoulder. Anything to get his attention…

So the chemistry was obviously there, but I was too blind to see it. Or too hardheaded, he was much too old for me! And kinky, too! For a while, he had a girlfriend, but I only remember seeing him with a girl once, and I remember not being entirely happy about it. Talk about living in denial!

When the summer of 2007 came around, I was tired of being alone. I had had a fling during the previous winter, but now I had no one, and it had been a while. I did try meeting guys, I had a profile up on a couple of dating sites, and I went to meet a few of them without ever any luck. And every weekend I’d go out to my usual spot and there was Boy Toy, ever sweet and ever flirty. I think the turning point, though, the moment I started to see Boy Toy in a whole new light, was when he gave me a shoulder rub. He was oh, so good at this, and I couldn’t help but imagine his hands elsewhere on my body… 

Then one night, my friend and I decided to go out to a different kind of club, the meet market type. We wanted to meet guys, maybe have a one night or something. But it turned out so horribly that we left and went to our usual spot. Boy Toy was there. And I was tempted, I really was, but I was way too shy to say anything. You want to know how lame I am? Here’s how it went:

At the end of the night, we were chatting outside, I was about to hail a cab and go home. Boy Toy looked back and saw this girl staring at us, and he said she had something for him and probably hated seeing us talk, probably imagined we’d leave together. And you want to know what I said?  I said “Why don’t you jump in the cab with me until the next street corner, that’ll show her!”

What I REALLY wanted to say was “Well, why don’t you jump in the cab with me?” But I couldn’t. And of course, the hint wasn’t obvious enough so he stayed behind.

The next day, we chatted some and we broached the subject of the previous night. I told him, in what I thought were no uncertain terms, what I had meant to say. I wish I remembered our conversation exactly… I think at one point I asked him what he’d have done if I had told him to jump in the cab, and he answered “What do you think?”. He then told me he was going to a friend’s for supper that night and he invited me.

I went. And after supper, we went out dancing. And after that, I ended up at Boy Toy’s place! I remember him looking up at me at one point and saying “Oh, that’s right, you’re here…” As if he couldn’t quite believe it. And that’s probably true, too. Boy Toy’s friend often tells me how, during that first year we knew each other but weren’t together, Boy Toy would always point me out and tell him how hot I was.

But anyway, back to that first night at Boy Toy’s… He gave me a massage and then we went to sleep, on his couch. He had his back to me and I put my arm around him. The next morning, I gave him a massage in return for his and then I went home. I couldn’t quite believe nothing had happened… We chatted online that week, though, and after much discussion concluded that we should be fuck friends. The following weekend, we went out dancing again, then went to his place. This time, something DID happen.

And that is how things started between Boy Toy and I. If you want to know how it started getting kinky, you can read some of my first posts, especially this one.

__________________________
Edit: Silly me, I forgot to address part of Axe’s question: how you can find someone like me. The answer is… I don’t know. I wasn’t into kink when I met Boy Toy, and so this isn’t what attracted him. He just thought I was hot and he went for me, and things turned out great for both of us. I wish you the same, Axe.